Tema Livre

TRABALHOS APROVADOS > RESUMO

Microvesículas séricas contendo DNA de arqueia como um novo fator patogenético na insuficiência cardíaca na doença de Chagas

Higuchi, ML, Kawakami, JT, Reis, MM, Oliveira, L, Pereira, JJ, Ianni, B, Buck, P, Dos Santos, MH, Bocchi, EA
INSTITUTO DO CORAÇÃO DO HCFMUSP - - SP - BRASIL

Introdução: Cerca de 30% dos pacientes com doença de Chagas (DC) evoluem com insuficiência cardíaca (IC) e miocardite, sem antígenos do Trypanosoma cruzi sugerindo ação de de outros fatores. Microvesículas, vesículas > 0,10mm, estão em número elevado no plasma de pacientes com IC. Nós descrevemos previamente, em biópsias de pacientes com IC e DC, microvesículas contendo DNA de arqueia. Agora pesquisamos no soro se microvesículas de arquéia e/ou com seus antígenos estão relacionados com IC na DC.

Métodos:Estudamos soros de pacientes com DC, 26 com IC e 21 com FI, submetidos a separação por gradiente de manitol/sacarose e centrifugação. O sobrenadante foi analisado para microvesículas pelo citômetro de fluxo (CF) calibrado com microesferas flourescentes de tamanho definido (0,79 a 1,34 μm) atraves dos métodos:  Hibridação in situ, utilizando sonda biotinilada, ARCH 915 (GTGCTCCCCCGCCAATTCCT) e incubada com PE-Texas Red e Streptavidina detectando microvesículas com DNA de arquéias; anticorpo anti-AMZ-1 (colagenase de arqueia) e anticorpo conjugado com Alexa Fluor detectando microvesiculas contendo colagenase de arquéia. As amostras foram analisadas com o software FlowJo (Tree Star). Comparação entre os grupos IC versus FI, foi feita com o teste Mann-Whitney e teste de correlação de Spearman, P <0,05.

Resultados: As % de microvesículas AMZ1 positivas foram maiores no grupo FI vs IC (P=0,02), e o nº de microvesiculas com DNA de arquéia maiores no grupo IC vs FI (P<0,001). Houve correlação negativa entre microvesículas AMZ1 positivas vs microvesiculas com DNA de arqueia (r=- 0,5; P=0,009) no grupo IC, sem correlação no grupo FI (r=- 0,004;P=0,98). 

Conclusões: Maior no. de microvesículas com DNA arquéia na IC sugere que tenham um papel patogênico na pior evolução da DC. No. Elevado de microvesículas contendo AMZ1 e negativas para DNA de arqueias sugere que estejam removendo e degradando a colagenase, protegendo contra evolução para IC. Estes achados, se confirmados em casuísticas maiores, trazem um novo foco terapêutico na doença de Chagas: a remoção de microvesículas infecciosas.

Realização e Secretaria Executiva

SOCESP

Organização Científica

SD Eventos

Agência Web

Inteligência Web
SOCESP

XXXIX Congresso da Sociedade de Cardiologia do Estado de São Paulo

31 de maio a 02 de junho de 2018
Transamerica Expo Center | São Paulo - Brasil